Background

The face of malaria control has deeply changed over the last few years; in the 2016 report of WHO, by 2015, the number of cases of malaria was estimated at 212 million and the related deaths at 429,000 worldwide. The WHO African region remains the most affected, with about 90% of cases of malaria and 92% of associated deaths in 2015. Globally, three-quarters of malaria cases and associated deaths are concentrated in fewer than 15 countries and one-third in Nigeria and the Democratic Republic of Congo (WHO, 2016). Several factors have contributed to this sharp decrease; predominately vector control through the use of pyrethroid as major insecticides for the Long-Lasting Impregnated Nets (LLINs) and household Indoor Spraying (IRS), during years, had played a fundamental role (Chandre et al., 1999a; 1999b; Diabate et al., 2015). However, the hopes aroused by this advance in the disease control and the substantial decrease in cases face the challenge of increasing insecticides resistance among major malaria vectors in African countries (Coluzzi et al., 1985; Weill et al., 2000; Favia et al., 2001; della Torre et al., 2001; Diabate et al., 2002b; Diabate et al., 2003; Ranson and Lissenden, 2016).

Resistance to insecticides is increasingly widespread and is now reported to affect nearly two thirds of countries where transmission persists. Furthermore, other chemical families of insecticides such as organochlorines and organophosphates had fallen into the ties of this phenomenon which now extends to all major vector species and all classes of insecticides. In 2011, the World Health Assembly and the Board of the Roll Back Malaria Partnership requested that action be taken to develop a global strategy on insecticide resistance management to serve as the foundation of a coordinated multi-stakeholder response. It becomes then necessary to set up a permanent watch of the evolution of the disease and especially the vectors’ bioecology. For this purpose, insecticide susceptibility tests were conducted to determine the level of vector resistance in the city of Lomé. The tests were carried out on wild-type Anopheles gambiae mosquitoes, using five insecticides. These include Permethrin, Deltamethrin, Bendiocarb, Fenitrothion and DDT. Moreover, a batch of mosquitoes was analyzed by PCR to identify vector species and detect mutations of the Kdr and Ace1R genes.

The results will enable malaria control programs to update data on the vector’s resistance to insecticides in order to guide strategies for resistance management leading to a more efficient vector control.

1 Materials and Methods

1.1 Study area and study sites

The study was conducted in three sites in Lomé (Latitude: 6.1375°N / Longitude: 1.2122° E, Figure 1), southern Togo, in West Africa. The capital city, as the south part of the country, has a Guinean type tropical climate, with two wet seasons, a longer in March to July and a shorter in October to November, and two dry seasons. The mean annual temperature is 26°C and the mean annual rainfall is approximately 810 mm. 

The population of the city, according to 2010 Population and Housing census data, exceeds the one million population mark (RGPH; 2010). The relief of the city presents two geographical entities consisting of a sandy plain and a clay plateau separated by a lagoon. The three test sites identified, representative of the main ecological features of the city (Figure 1) are as follows: the area of Adakpame (1.282275° E, 6.167656° N), Doumasese -Dogbeavu neighbourhoods (1.212151° E, 6.157137° N) and the Nyékonakpoè district (1.205440° E, 6.134076° N).

The main criterion for selecting these sites is the presence of surface water all the year, potential mosquitoes breeding sites, for larval collections, in relation with urbanization level. 

1.2 Larval collections

Visits to the study sites were conducted monthly from 2013 to 2015. The collection of larvae were performed using very fine mesh larvae net. In small puddles or shallow water, ladles are used to collect the water containing the larvae. Plant debris and other wastes are removed from the water and these are brought back to the laboratory for breeding. The larvae were fed with enriched flour (BLEDINA®) for children. The larvae were reared in a room where the temperature is 28±3°C and an averaged relative humidity around 75±5% until they emerge into adults. 

1.3 Insecticide bioassays

3 to 5 days old female An. gambiae s.l. were selected for the susceptibility tests according to the standard procedure for testing adult anopheline susceptibility to insecticides (WHO, 1998). Between 15 and 25 mosquitoes were used for the tests in each WHO tube. These tests were carried out with papers impregnated with Deltamethrin 0.05%, Permethrin 0.75%, DDT 4%, Bendiocarb 0.1% and Fenitrothion 1%. The choice of diagnostic doses of impregnated papers is based on WHO recommendations for these tests (WHO, 1998). The sensitivity of mosquitoes to Delthametrin was compared to the other insecticides and a control paper, according to standard WHO procedures. DDT was tested for cross-resistance between pyrethroid and organochlorines while the test with Fenitrothion was to show cross-resistance between pyrethroid and organophosphates. The mosquitoes were exposed to the impregnated papers for 60 minutes, and observed for 24 hours in order to assess the mortality rates.

As soon as the mosquitoes were exposed to the impregnated papers, the number of mosquitoes "knocked down" (Kd) at the bottom of the WHO tubes was registered after 10, 20, 30, 45 and 60 minutes. After the tests, the dead and live specimens were stored separately on silica gel in 1.5 ml Eppendorf tubes and stored in a freezer (at -20°C) for later biochemical and molecular analyses. In the present study, a population was considered as susceptible when the mortality is greater than or equal to 96%. When mortality is less than 90% the population is considered as resistant. Between the two values, the situation was considered as a suspicion of resistance (decrease in sensitivity). A control batch had been prepared with the sensitive Kisumu (SLAB) which is a reference strain reared in laboratory.

1.4 Extraction of DNA from the female mosquitoes

Each mosquito from the insecticide susceptibility assay was cut into two parts: one part constituted of the head-thorax and the other, with the abdomen, wings and legs. The two parts were put into separate tubes. These were ground in 200 μl of 2% CTAB buffer containing 100 mM Tris HCL, pH8.0, 1.4 M NaCl, 10 mM EDTA and 2 % Cetyl Trimethyl Ammonium Bromide, and introduced into a water bath at 65°C for 5 minutes. 200 μl of chloroform was added and then centrifuged at 14,000 rpm for 5 min. The supernatant was carefully transferred in another sterile tube with 200 μl of isopropanol and then centrifuged at 12,000 rpm for 15 minutes. The supernatant was discarded and the pellet was washed with 200 μl 70% ethanol and centrifuged at 14,000 rpm for 5 min. The contents of the tube were delicately inverted to preserve the pellet which was then dried for 3 hours on the pallet. At the end, 20 μl of double distilled water was added to the pellet and kept on the pallet all night. The DNA was used for the identification of species and molecular forms of the Anopheles gambiae complex.

1.5 Identification of Anopheles gambiae sibling species

The DNA extracted permitted species identification which was based on the protocol of Scott et al. (1993). Four primer sets: UN (GTGTGCCGCTTCCTCGATGT), AG (CTGGTTTGGTCGGCACGTTT), AA (AAGTGTCCTTCTCCATCCTA) and AM (GTGACCAACCCACTCCCTTGA), derived from ribosomal gene sequences (IGS of the rDNA located in the heterochromatin of the X chromosome) specific for the Anopheles species (gambiae, arabiensis and melas) were used. The molecular forms were determined using four primers: R5 (GCAATCCGAGCTGATAGCGC), R3 (CGAATTCTAGGGAGCTCCAG), Mop int (GCCCCTTCCTCGATGGCAT) and B/S int (ACCAAGATGGTTCGTTGC) corresponding to ribosomal gene sequences (rDNA IGS), according to the method of Favia et al. (2001).

1.6 Detection of the kdr mutation in mosquitoes

100 adult mosquitoes tested with DDT and Permethrin were used to detect the Knock down resistance gene following the PCR method of Martinez et al. (1998). Four primers were used; the first two: D1 5’ATAGATTCCCCGACCATG3’ D2 5’AGACAAGGATGATGAACC3’ in amplifying the Na-canal gene containing the site of Kdr mutation and the last two: D3 5’AATTTGCATTACTTACGACA3’ and D4 5’CTGTAGTGATAGGAAATTTA3’ for genotyping the resistant allele mutation Kdr and the susceptible allele Kdr respectively.

1.7 Detection of the Ace-1 mutation in mosquitoes

The characterization of the Ace-1 polymorphism was done using two primers: Ex3AGdir GATCGTGGACACCGTGTTCG and Ex3AGrev AGGATGGCCCGCTGGAACAG, and following the methods of Weill, et al. (2003).

1.8 Data analyses

The kdr PCR results for the genotypes obtained were analyzed using the Genepop software (version 3.2a) of Raymond and Rousset (1995) to calculate the allele frequencies, to compare the populations with each other, and to differentiate the genotypic frequencies between populations. Tests regarding kdr and Ace-1 mutations was tested using Fisher’s exact test. For each enzyme system, the mean activity per population is calculated and compared with that of the "Kisumu" reference susceptible strain with the nonparametric Kruskall-Wallis and Mann-Whitney U tests at the CI of 5%.

2 Results

2.1 Insecticide susceptibility testing

The results of Anopheles susceptibility to the five insecticides used during the tests are presented in Figure 2 (1-5). Throughout the three years, approximately 7,500 mosquitoes were tested with the five insecticides. The results revealed resistance to Bendiocarb with mortality rates of 38.2%, 47.2% and 46.8% respectively in Adakpame, Doumasese and Nyékonakpoè (Figure 2-1). High resistance to organochlorine DDT was also detected, from the study sites, with mortality rates of 17% for the peripheral zone, 24% for Adakpame, Doumasese and Nyékonakpoè (Figure 2-2). 

There was resistance to type I (Permethrin) and type II (Deltamethrin) pyrethroid in the An. gambiae s.l. tested from the various study sites, with mortality rates being 38.6% (Permethrin) and 33.5% (Deltamethrin) in Adakpame, 49% and 45% (Permethrin and Deltamethrin respectively)) in Doumasese areas, while in Nyékonakpoè, the mortality rates were 38.6% and 30% respectively for Permethrin and Deltamethrin (Figure 2-3; Figure 2-4).

The organophosphate Fenitrothion revealed a high susceptibility with mortality rates of 98.6% in Adakpame, 98.4% in Doumasese zone and 98.5% and Nyékonakpoè (Figure 2-5). 

The control strain KISLAB exhibited very high sensitivity to the insecticides tested: 99% mortality to carbamate, 100% mortality to the organochlorine and the type I pyrethroid, 99.7% mortality to the organophosphate and 99.3% mortality to the type II pyrethroid.

2.2 Resistance mechanisms in the Anopheles gambiae strains from the study sites:

2.2.1 Detection of the Kdr and Ace-1r genes

Mosquitoes from each study site were used for the detection of the Kdr gene.

In the peripheral zone, in Adakpame, the Kdr gene was strongly expressed with a frequency of 0.79 as well as in suburban zone Doumasese with a frequency of 0.78; In the urban area of Nyékonakpoè, the frequency of expression of the Kdr gene was 0.89 (Table 1). Over all, the frequency of the Kdr gene in Lomé was 0.82 (Table 1).

Analyses for the Ace 1 mutation releaved all mosquitoes tested to be sensitive SS homozygotes (Frequency Ace-1r =0).

2.2.2 Identification of Anopheles gambiae sibling species 

Concerning the species of the Anopheles collected in the study sites, the results from the PCR analyses showed an exclusivity of Anopheles gambiae s.l. with An. gambiae s.s. and An. coluzzii with respective frequencies of 92% and 8% in Adakpame, 84 and16% in Doumasese and 66and 34% in Nyékonakpoè. The results showed an average in forms in Lomé of 81% An. gambiae and 19% An. coluzzii (Table 2).

3 Discussions

The present study aimed to update the entomological data of malaria vector, Anopheles gambiae s.l., in three selected representative bio ecologic areas: an urban, a suburban and a peripheral areas of the city of Lomé. These data took in account the actual susceptibility to insecticides, the various species subservient to the town, the status of the Knock down gene as well as the Ace1 and the metabolic resistance mechanisms.

Results from the OMS susceptibility tests showed Anopheles gambiae s.l., the major malaria vector in Africa, presenting strong resistance to four of the five insecticides at study sites: the peripheral zone of Adakpame, the suburban zone of Doumasese and the urban area of Nyékonakpoè in the city of Lomé. The data collected showed resistance to pyrethroid (types I & II), carbamates and organochlorines across all study sites. As stated by several studies (Mouchet et al., 1988; Yadouleton et al., 2011; Ranson et al., 2011; Mahande et al., 2012), the mass use of pesticides in vegetables’ protection  confer the resistance in mosquitoes. The influence of crops and the use of insecticides for vegetable protection are not direct in the city, the vegetable producing sites in the town do not make a large proportion of areas in the city to influence deeply the emergence of resistance in the anopheline strains. The city of Lomé, according to its topography, with its clayey-sandy plateau, oriented East-West, dotted with Watersheds or Talwegs (Direction de l’Assainissement, unpublished data) which retain surface moving water during rains, presents no connection with any stream that could drain chemical residues to the city. The Zio River, passing from Northside by the close rice fields of Kovié and its surroundings, supplying the areas with water and collects the overflow from the fields which it drains downstream and towards North Lomé areas, could discharge the pesticide residues in the outskirts of Adakpame at the extreme East. However, given the amount of water drained and the current flowing to its outlet, which is Lake Togo, 35 km Eastside from the city, it is expected the amount of residues released at Adakpame should not be high enough to induce large-scale resistance. On the other hand, the migration of adults mosquitoes by the wind and the means of road communications towards Lomé, along a shorter distance than the river’s one, could suggest intersections between the strains with migration and dispersion of resistance genes (Weill et al., 2003; Migration and genetic drift, Poupardin, 2011).

Beyond the resistance expressed by the local strains collected in the study sites, the consequence of small-area crops and non-market gardening crops made up of beans, millet, sorghum, cassava, yam, sweet potatoes and vegetables that do not require insecticides or Fertilizer, it is very likely to suspect a "partial import" of resistance from the periphery to the city.

Concerning the household individual and collective protection against mosquitoes’ aggression and nuisance, the use of insecticide products, such as aerosols and mosquito coils must have rendered field selection pressure towards the family of insecticides in mosquitoes (Fonseca-Gonzalez et al., 2011; Koou et al., 2014); but the main idea is that in the name of the instinct of conservation and survival, only the trapped mosquitoes face the insecticide aggression; in free spaces, the mosquito escapes the influence of the insecticides by flying far from the dangerous zone. This leads to conclude that even though the household use of insecticides could lead to the emerging of resistance, it could be at a smaller part among the whole insecticide aggression towards the insects since the pre imaginal stages in shallows and breeding sites face longer the pesticide residues. The larvae of all instars face more selection pressure towards the families of insecticides in the aquatic stage of life; as reported by Yadouleton et al. (2016), pesticide treatments cause movement of chemical particles from pesticide residues to larval breeding habitats and are the major causes leading to selection of resistance in arthropods, particularly in Cx. quinquefasciatus.

Indeed, it is necessary to imagine the migration of the resistant Anopheles strains from the intensive cultivation zones, in particular the close rice fields of Kovié and the whole Zio valley, along the winds and means of road transport towards the capital of Togo, and other agglomerations. This leads to dispersion of resistance genes achieved by mixing the local strains of the city with the field’s ones coming from areas with high pesticide use, as stated by and Raymond et al. (1991); Guillemaud et al. (1996); Ouedraogo et al. (2004); V. Corbel and R. N’Guessan (2013).

Two major types of resistance appeared in the results: the Knockdown resistance (kdr) showing the genetic aspect of resistance to DDT and pyrethroid and the "metabolic aspect of resistance", resulting from enhanced expression of detoxification enzymes (Hemingway et al., 2000). The second type of resistance will be discussed in another publication.

Results of the study showed the mosquitoes resistant to DDT, and pyrethroid and were close to several authors ones evoking cross resistance. The cross-resistance between DDT and pyrethroid in An. gambiae is closely linked to the kdr mutation in this species as noted in reviews by Martinez-Torres et al. (1998); Chandre et al. (1999); Hemingway and Ranson (2000); Ranson et al. (2000). The fact of cross-resistance to DDT (organochlorine), to Deltamethrin and Permethrin (type I and II pyrethroid) (Chandre et al., 1999; Hemingway and Ranson, 2000) in strains originating from study sites is a consequence of intensive use of agricultural pesticides directed against crop pests in vegetable, rice and cotton fields, causing collateral damage to the non-target entomofaune namely the Cuicidae (Yadouleton et al., 2016).

The resistance of An. gambiae s.l. to carbamate Bendiocarb, showed by the results, could be explained by the use of this chemical product during intra-home spraying by the National Malaria Control Program since 2010 in Benin. Carbamate have as target the Ace1 gene in the mosquitoes. The activity of intra room spraying with carbamate was not carried out in Togo. This could explain the homozygote susceptible (100% SS) Ace-1 gene found in the study sites of Lomé. In this border country of Togo, the insecticide had been used as an alternative to pyrethroid (Padonou, 2012) and had reduced the transmission of malaria in the country, as pointed out by Akogbeto et al. (2010); Aïkpon et al. (2013), but the selection of the acetylcholinesterase mutation within the populations of An. gambiae s.l. has been recognized in relation with its repeated frequency in the use of carbamate in domestic hygiene. The fact of meeting carbamate resistant strains however bearing Ace-1 SS homozygote mosquitoes in Lomé seemed to show no relationship between the two situations as stated by Donnelly et al. (2009) inviting to deeper analysis of the relationship presented by several previous work.

The work of Yadouleton et al. (2011), reported that in addition to the use of this carbamate in public health, intensive and especially uncontrolled use of the Tihan, insecticide of the carbamate family, was made in Natitingou and its surroundings to control cultures pests.

The results of this research work still revealed the selection of resistance within populations of An. gambiae s.l. to pyrethroid, organochlorines and carbamates. The work of Ahadji-Dabla et al. (2014), reported this situation without mentioning the case of carbamates. These authors claim that the strong resistance to DDT could be linked to the use of this organochlorine by the colonizer in 1952 in the malaria vectors control activities in Lomé at the creation of the Malaria Control Service which had become the National Malaria Control Program (NMCP). Moreover, the high expressions of the Kdr mutation in the Anopheles gambiae s.l. wild strains could suggest the NMCP to take appropriate measures for a judicious use of chemical pesticides in household hygiene as well as in the protection against crops pests.

Concerning the organochlorine DDT, the results of this work had showed mortality rates of 17% for the peripheral zone, 24% for the suburban and 29% for the urban area, showing thus a decrease in resistance to this product (DDT) from the periphery to the urban environment. Data of Coetzee et al., 2006, reported higher mortality rates with DDT than in Lomé. From assays against wild mosquitoes’ strains, they showed a level of resistance to DDT of 60.9% as final mortality rate but without cross resistance to pyrethroid; these authors had presented 100% as final mortality rate recorded with Deltamethrin and cyfluthrin. These authors linked the discrepancy in the results with the age at which the strains were exposed to the insecticides suspecting an age dependent variability in the physiological status in the batches of the mosquitoes tested.

In the present work, experiments on the Ace-1 gene had showed the anopheline wild strains to be exclusively sensitive homozygotes (frequency Ace-1 = 0). This gene, as stated by Weill et al. (2003), is the target of the organochlorine and carbamate insecticides. The wild-type An. gambiae s.l. strains tested in the experiments during this work did not show an Ace-1R mutation. Okoye et al., in 2008 in Ghana, reported many Cuicidae families presenting reduced acetylcholinesterase sensitivity to propoxur inhibition. Coetzee et al. (2006), by the standard WHO insecticide susceptibility method for wild mosquito strains, showed Obuasi An. funestus strains carrying resistance to the carbamate Bendiocarb thus the Ace1R gene with a final mortality rate of 71.4%, 24 hours after exposure.

As suggested above, a method of judicious chemical control would lead to the control of resistance in mosquitoes by a combination of insecticides (Pennetier et al., 2005; 2007) or by alternating insecticides (Yadouleton et al., 2016 ) such a method would result in long lasting in the impregnation activities of the bed-nets and their use against the Culicidae nuisance.

The work of Corbel et al. (2007) highlights this as a major consequence of the high Kdr gene frequencies in An. gambiae s.l. in the collected batches (Table 1). The Kdr mutation had been noted in Togo by Ketoh et al. (2009) and had also been reported by works from many other West African countries where high kdr frequencies had been showed in An. gambiae s.l. namely in Côte d’Ivoire, Burkina Faso, Benin, Ghana and Nigeria (Yawson et al., 2004; Awolola et al., 2005; Corbel et al., 2007; Djogbénou et al., 2007; Oduola et al., 2010; Yadouleton et al., 2011; Dabire et al., 2012; Koffi et al., 2012), as well as in Central Africa particularly in countries such as Equatorial Guinea and Cameroon by Nwane et al. (2009), Etang et al. (2006) and Reimer et al. (2005).

As proposed by Yadouleton et al. (2016), to quantify both Kdr and Ace-1R genes in Benin where they had showed very high frequencies, in Togo it is necessary to quantify over time the Kdr gene by the qPCR technique.

The results of detection of Ace1 showed Malaria vectors in Lomé to be exclusively homozygote susceptible (SS). This could mean that the use of insecticides which targets are acetylcholinesterase, were did not yet lead to the mutation of the Ace1 gene. To monitor the Ace-1 gene which does not yet have presented a mutation becomes necessary with a view to better resistance management in An. gambiae s.l. for optimum control of malaria in the town.

In Mali, in the 1960s, the selective role of organochlorine (OC) treatments leading to developing resistance in Cuicidae, particularly vectors, was observed in areas free from public health treatments but rather in Agriculture (Yadouleton et al., 2016). In other countries, notably Côte d'Ivoire and Burkina Faso, the late 1990s saw an increase in the level of resistance of vectors to pyrethroid insecticides resulting from the cotton season with pesticide treatments (Chandre et al., 1999).

4 Conclusions

The multi insecticide resistance levels in Anopheles gambiae s.l. reported in the present work, left to a continuous selection pressure in these vectors, will lead inexorably to a situation of mosquito and malaria management, by use of insecticide treated bed-nets and indoor residual spraying, beyond efforts of the Malaria Control Program authorities if unchecked. This resistance could spread rapidly and weaken or even undermine the hope generated by the control of the disease through vector control in efforts in reducing malaria across Africa.

Therefore, the results presented in the present work are aiming directing the NMCP authorities to plan an effective malaria control strategy in the Lomé area by a judicious resistance management in the city. An integrated vector management system including alternative and/or combination use of insecticides, for indoor residual spraying, for impregnation of bed-nets, in house screening and, finally, larval control by environmental and larval habitats control and management, can be taken into account by the malaria control authorities.

List of abbreviations

CREC: Centre de Recherches Entomologiques de Cotonou

EGESE: Ecole de Gestion et d’Exploitation de Systèmes d’Elevage

ESTBA: Ecole Supérieure des Techniques Biologiques et Alimentaires

FDS: Faculté des Sciences

NMCP: National Malaria Control Program

UAK: Université d’Agriculture de Ketou

Authors’ contributions

AK designed the study and carried out the experiments. OR participated in sampling the mosquitoes and controlled the laboratory results. SA conducted biochemical and biomolecular analyzes. OLM has been involved in the treatment of mosquitoes for biochemical analyzes. AK and MA drafted the manuscript. DAM and OLM read the first manuscript and provided pieces of advice for correction. GA and MA critically revised the manuscript. AK and DAM translated the manuscript. All the authors read and approved the final manuscript.

Acknowledgements

We are grateful to the master level students of the CREC who helped in grinding the mosquitoes’ specimens. The authors wish to thank Mr. De Souza Dziedzom, from Nogushi Memorial Institute, who corrected the translated version of the manuscript; and, at last, the populations of Adakpame, Doumasese, Dogbeavu, and Nyékonakpoè Lomé for allowing and helping the mosquitoes sampling.

References

Aïkpon, R., Agossa, F., Ossè, R., Oussou, O., Aïzoun, N., Oké-Agbo, F., and Akogbéto, M., 2013, Bendiocarb resistance in Anopheles gambiae sl. populations from Atacora department in Benin, West Africa: a threat for malaria vector control, Parasites & vectors, 6(1): 192

https://doi.org/10.1186/1756-3305-6-192

PMid:23803527 PMCid:PMC3698110

Akogbeto M., Padonou G., Gbenou D., Irish S., and Yadouleton A., 2010, Bendiocarb, a potential alternative against pyrethroid resistant Anopheles gambiae in Benin, West Africa, Malar J, 9: 204

https://doi.org/10.1186/1475-2875-9-204

PMid:20630056 PMCid:PMC2912925

Awolola T.S., Oyewole I.O., Amajoh C.N., Idowu E.T., Ajayi M.B., Oduola A., Manafa O.U., Ibrahim K., Koekemoer L.L., and Coetzee M., 2005, Distribution of the molecular forms of Anopheles gambiae and pyrethroid knock down resistance gene in Nigeria, Acta Tropica, 95: 204-209

https://doi.org/10.1016/j.actatropica.2005.06.002

PMid:16023989

Abdoulaye D., Thierry B., Chandre C. et al., 2003, "KDR mutation, a genetic marker to assess events of introgression between the molecular M and S forms of Anopheles gambiae (Diptera: Culicidae) in the tropical savannah area of West Africa." Journal of Medical Entomology, 40(2): 195-198

https://doi.org/10.1603/0022-2585-40.2.195

Beier M.S., Schwartz I.K., Beier J.C., Perkins P.V., Onyango F., Koros J.K., and Brandling-Bennett A.D., 1988, Identification of malaria species by ELISA in sporozoite and oocyst infected Anopheles from western Kenya, The American journal of tropical medicine and hygiene, 39(4): 323-327

https://doi.org/10.4269/ajtmh.1988.39.323

PMid:3056055

Chandre F., Darriet F., Duchon S., Finot L., Manguin S., Carnevale P., and Guillet P., 1999, Pyrethroid cross resistance spectrum among populations of Anopheles gambiae s.s. from Cote d'Ivoire, J Am Mosq Control Assoc, 5: 53-59

Chandre F., Manguin S., Brengues C., Dossou Yovo J., Darriet F., Diabate A., Carnevale R., and Guillet P., 1999, Current distribution of a pyrethroid resistance gene (kdr) in Anopheles gambiae complex from West Africa and further evidence for reproductive isolation of the Mopti form, Parassitologia, 41: 319-322

Coetzee M., van Wyk P., Booman M., Koekemoer L.L., and Hunt R.H., 2006, Insecticide resistance in malaria vector mosquitoes in a gold mining town in Ghana and implications for malaria control, Bull, Soc. Pathol. Exot., 99, 400-403

Coluzzi M., Petrarca V., Di and Deco M.A., 1985, Chromosomal inversion intergradation and incipient speciation in Anopheles gambiae, Boll Zoll, 52: 45-63

https://doi.org/10.1080/11250008509440343

Corbel V., N’Guessan R., Brengues C., Chandre F., Djogbenou L., Martin T., Akogbeto M., Hougard J.M., and Rowland M., 2007, Multiple insecticide resistance mechanisms in Anopheles gambiae and Culex quinquefasciatus from Benin, West Africa, Acta Trop, 101: 207-216

https://doi.org/10.1016/j.actatropica.2007.01.005

PMid:17359927

Corbel V., and N’Guessan R., 2013, Distribution, mechanisms, impact and management of insecticide resistance in malaria vectors: a pragmatic review, Anopheles mosquitoes-New insights into malaria vectors, 633

Diabate A., and Tripet F., 2015, Targeting male mosquito mating behaviour for malaria control, Parasites & vectors, 8(1): 347

https://doi.org/10.1186/s13071-015-0961-8

PMid:26113015 PMCid:PMC4485859

Dabire R.K., Namountougou M., Sawadogo S.P., Yaro L.B., Toe H.K., Ouari A., Gouagna L.C., Simard F., Chandre F., Bass C., and Diabate A., 2012, Population dynamics of Anopheles gambiae s.l. in Bobo- Dioulasso city: bionomics, infection rate and susceptibility to insecticides, Parasites & Vectors, 5: 127

https://doi.org/10.1186/1756-3305-5-127

PMid:22721002 PMCid:PMC3424103

Della Torre A., Fanello C., Akogbeto M., Dossou-Yovo J., Favia G., Petrarca V., and Coluzzi M., 2001, Molecular evidence of incipient speciation within Anopheles gambiae s.s. in West Africa, Insect Mol Biol 10: 9-18

https://doi.org/10.1046/j.1365-2583.2001.00235.x

PMid:11240632

Diabate A., Baldet T., Chandre F. et al., 2002, First report of the kdr mutation in Anopheles gambiae M form from Burkina Faso, west Africa, Parassitologia, 44(3-4): 157-158

Djogbénou L., Weill M., Hougard J.M., Raymond M., Akogbeto M., and Chandre F., 2007, Characterization of insensitive acetylcholinesterase (ace-1R) in Anopheles gambiae (Diptera: Culicidae): resistance levels and dominance, J. Med. Entomol., 44: 805-810

https://doi.org/10.1093/jmedent/44.5.805

PMid:17915512

Donnelly M.J., Corbel V., Weetman D., Wilding C.S., Williamson M.S., and Black W.C., 2009, Does kdr genotype predict insecticide-resistance phenotype in mosquitoes? Trends in parasitology, 25(5): 213-219

https://doi.org/10.1016/j.pt.2009.02.007

PMid:19369117

Etang J., Fondjo E., Chandre F., Morlais I., Brengues C., Nwane P., Chouaibou M., Ndjemai H., and Simard F., 2006, First report of knock down mutations in the malaria vector Anopheles gambiae from Cameroon, Am. J. Trop. Med. Hyg., 74: 795-797

Favia G., Lanfiancotti A., Spanos L., Sidén-Kiamos I., and Louis C., 2001, Molecular characterization of ribosomal DNA polymorphisms discriminating among chromosomal forms of Anopheles gambiae ss. Insect, Mol. Biol, 10: 19-23

https://doi.org/10.1046/j.1365-2583.2001.00236.x

PMid:11240633

Fonseca‐González I., Quiñones M.L., Lenhart A., and Brogdon W.G., 2011, Insecticide resistance status of Aedes aegypti (L.) from Colombia, Pest management science, 67(4), 430-437

https://doi.org/10.1002/ps.2081

PMid:21394876

Guillemaud T., Rooker S., Pasteur N., and Raymond M., 1996, Testing the unique amplification event and the worldwide migration hypothesis of insecticide resistance genes with sequence data, Heredity, 77(5): 535-543

https://doi.org/10.1038/hdy.1996.181

PMid:8939020

Hemingway J., Hawkes N., Prapanthadara L., Jayawardenal K.G., and Ranson H., 1998, The role of gene splicing, gene amplification and regulation in mosquito insecticide resistance, Philos Trans R Soc Lond B Biol Sci, 353(1376): 1695-1699

https://doi.org/10.1098/rstb.1998.0320

PMid:10021769 PMCid:PMC1692393

Hemingway J., and Ranson H., 2000, Insecticide resistance in insect vectors of human disease, Annu, Rev, Entomol, 45: 371-391

https://doi.org/10.1146/annurev.ento.45.1.371

PMid:10761582

Hemingway J., Hawkes N.J., McCarroll L., and Ranson H., 2004, The molecular basis of insecticide resistance in mosquitoes, Insect Biochem Mol Biol, 34: 653-666

https://doi.org/10.1016/j.ibmb.2004.03.018

PMid:15242706

Ketoh K.G., Morgah K., Akogbéto M., Faye O., and Glitho I.A., 2005, Insecticide Susceptibility Status of Anopheles Populations in Togo, J. Rech., Sci. Univ. Lomé, Serie A, 7(2): 13-22

Koffi A.A., Ahoua Alou L.P., Adja M.A., Koné M., Chandre F., and N’Guessan R., 2012, Update on resistance status of Anopheles gambiae s.s. to conventional insecticides at a previous WHOPES field site, “Yaokoffikro”, 6 years after the political crisis in Côte d’Ivoire, Parasites & Vectors, 5: 68

Koffi Mensah Ahadji-Dabla, Guillaume Koffivi Ketoh, Wolali S. Nyamador, Georges Yawo Apétogbo and Isabelle Adolé Glitho: Susceptibility to DDT and pyrethroid, and detection of knockdown resistance mutation in Anopheles gambiae sensu lato in Southern Togo; Int. J. Biol. Chem. Sci., 8(1): 314-323

Koou S.Y., Chong C.S., Vythilingam I., Lee C.Y., and Ng L.C., 2014, Insecticide resistance and its underlying mechanisms in field populations of Aedes aegypti adults (Diptera: Culicidae) in Singapore, Parasites & vectors, 7(1): 471

https://doi.org/10.1186/s13071-014-0471-0

PMid:25301032 PMCid:PMC4201922

Kumar R.A., et al., 1996, Functional characterization of the precursor and spliced forms of RecA protein of Mycobacterium tuberculosis, Biochemistry 35(6): 1793-1802

https://doi.org/10.1021/bi9517751

PMid:8639660

Lhuillier M., Sarthou J.L., Cordellier R., Monteny N., Gershy-Damet G.M., and Bouchite B., 1986, Emergence endémique de la fièvre jaune en Côte d'Ivoire: place de la détection des IgM antiamariles dans la stratégie de surveillance, Bulletin of the World Health Organization, 64(3): 415

Mahande A.M., Dusfour I., Matias J.R., and Kweka E.J., 2012, Knockdown Resistance, rdl Alleles, and the Annual Entomological Inoculation Rate of Wild Mosquito Populations from Lower Moshi, Northern Tanzania, J Glob Infect Dis, 4(2): 114-119

https://doi.org/10.4103/0974-777X.96776

PMid:22754247 PMCid:PMC3385201

Martinez-Torres D., Chandre F., Williamson M.S., Darriet F., Berge J.B., Devonshire A.L., Guillet P., Pasteur N. and Pauron D., 1998, Molecular characterization of pyrethroid knockdown resistance (kdr) in the major malaria vector Anopheles gambiae s.s. Insect Mol Biol., 7(2): 179-184

https://doi.org/10.1046/j.1365-2583.1998.72062.x

PMid:9535162

Mouchet J., 1998, Mini-Review: Agriculture and Vector Resistance, Insect Sci Applic, 9(3): 291-302

Nwane P., Etang J., Chouaibou M., Toto J.C., Kerah-Hinzoumbe C., Mimpfoundi R., Awono-Ambene H.P., and Simard F., 2009, Trends in DDT and pyrethroid resistance in Anopheles gambiae s.s. populations from urban and agroindustrial settings in southern Cameroon, BMC Infect. Dis., 9: 163

https://doi.org/10.1186/1471-2334-9-163

PMid:19793389 PMCid:PMC2764715

Oduola A.O., Olojede J.B., Ashiegbu C.O., Adeogun A.O., Otubanjo O.A., and Awolola T.S., 2010, High level of DDT resistance in malaria mosquito: Anopheles gambiae s.l. from rural, semi urban and urban communities in Nigeria, J. Rural Trop. Public Health, 9: 114-120

Okoye P.N., Brooke B.D., Koekemoer L.L., Hunt R.H., and Coetzee M., 2008, Characterisation of DDT, pyrethroid and carbamate resistance in Anopheles funestus from Obuasi, Ghana, Transactions of the Royal Society of Tropical Medicine and Hygiene, 102(6): 591-598

https://doi.org/10.1016/j.trstmh.2008.02.022

PMid:18405930

Padonou G.G., 2012, Contrôle de Anopheles gambiae (Diptera, Nematocera, Culicidae), vecteur du paludisme, par le Bendiocarb en pulvérisation intra domiciliaire à grande échelle dans le département de l’Ouémé au Bénin; thèse de Doctorat, Université d’Abomey-Calavi, pp.258

Pennetier C., Corbel V., and Hougard J.M., 2005, Combination of a non-pyrethroid insecticide and a repellent: a new approach for controlling knockdown-resistant mosquitoes, The American journal of tropical medicine and hygiene, 72(6): 739-744

Pennetier C., Corbel V., Boko P., Odjo A., N'Guessan, R., Lapied B., and Hougard J.M., 2007, Synergy between repellents and non-pyrethroid insecticides strongly extends the efficacy of treated nets against Anopheles gambiae-art. no. 38. Malaria Journal, 6, NIL_1-NIL_7.

Pongjaroenkit S., Jirajaroenrat K., Boonchauy C., Chanama U., Leetachewa S., Prapanthadara L., Ketterman A.J., 2001, Genomic organization and putative promoters of highly conserved glutathione S-transferases originating by alternative splicing in Anopheles dirus, Insect Biochem. Mol. Biol. 31: 75-85

https://doi.org/10.1016/S0965-1748(00)00107-7

Ranson H., Jenson B., Vulule J.M., Wang X., Hemingway J., and Collins F.H., 2000, Identification of a point mutation in the voltage-gated sodium channel gene of Kenyan Anopheles gambiae associated with resistance to DDT and pyrethroid, Insect Mol. Biol. 9: 491-497

https://doi.org/10.1046/j.1365-2583.2000.00209.x

PMid:11029667

Ranson H., and Hemingway J., 2005, Mosquito glutathione transferases, Review, Methods Enzymol., 401: 226-241

https://doi.org/10.1016/S0076-6879(05)01014-1

Ranson H., and Lissenden N., 2016, Insecticide resistance in frican Anopheles mosquitoes: A worsening situation that needs urgent action to maintain malaria control, Trends Parasitol 32: 187-196

https://doi.org/10.1016/j.pt.2015.11.010

PMid:26826784

Ranson H., N'Guessan R., Lines J., Moiroux N., Nkuni Z., and Corbel V., 2011, Pyrethroid resistance in African anopheline mosquitoes: what are the implications for malaria control? Trends Parasitol, 27(2): 91-98

https://doi.org/10.1016/j.pt.2010.08.004

PMid:20843745

Raymond M., Callaghan A., Fort P., and Pasteur N., 1991, Worldwide migration of amplified insecticide resistance genes in mosquitoes, Nature, 350: 151-153

https://doi.org/10.1038/350151a0

PMid:2005964

Raymond M., and Rousset F., 1995, GENEPOP (v 1.2): A population genetics software for exact tests and ecumenicism, Journal of Heredity, 86: 248-249

https://doi.org/10.1093/oxfordjournals.jhered.a111573

Reimer L.J., Tripet F., Slotman M., Spielman A., Fondjo E., and Lanzaro G.C., 2005, An unusual distribution of the kdr gene among populations of Anopheles gambiae on the island of Bioko, Equatorial Guinea, Insect Mol. Biol., 14: 683-688

https://doi.org/10.1111/j.1365-2583.2005.00599.x

PMid:16313568

RGPH, Recensement Général de la Population et de l’ES, 2010, extrait; Direction des Statistiques et de la Comptabilité Nationales

Scott J.A., Brogdon W. and Collins F.H., 1993, Identification of single specimens of the Anopheles gambiae complex by the polymerase chain reaction, Am J Trop Med Hyg, 49(4): 520-529

https://doi.org/10.4269/ajtmh.1993.49.520

PMid:8214283

Sant’Anna M.R., Jones N.G., Hindley J.A. et al., 2008, Blood meal identification and parasite detection in laboratory-fed and field-captured Lutzomyia longipalpis by PCR using FTA databasing paper, Acta tropica, 107(3): 230-237

Ouedraogo T.D.A., Baldet T., Skovmand O., Kabre G., and Guiguemde T.R., 2005, Sensibilité de Culex quinquefasciatus aux insecticides à Bobo Dioulasso (Burkina Faso) Bull Soc Pathol Exot, 98(5): 406-410

Weill M., Chandre F., Brengues C., Manguin S., Akogbeto M., Pasteur N., Guillet P., and Raymond M., 2000, The kdr mutation occurs in the Mopti form of Anopheles gambiae s.s. through introgression, Insect Mol Biol, 9: 451-455

https://doi.org/10.1046/j.1365-2583.2000.00206.x

PMid:11029663

Weill M., Duron O., Labbé P., Berthomieu A., and Raymond M., 2003, La résistance du moustique Culex pipiens aux insecticides, médecine/sciences, 19(12): 1190-1192

Weill M., Lutfalla G., Mogensen K., et al., 2003, Comparative genomics: Insecticide resistance in mosquito vectors, Nature, 423(6936): 136-137

https://doi.org/10.1038/423136b

PMid:12736674

Wirtz R.A., Zavala F., Charoenvit Y., et al., 1987, Comparative testing of monoclonal antibodies against Plasmodium falciparum sporozoites for ELISA development, Bulletin of the World Health Organization, 65(1): 39

World Health Organization, 1998, Test procedures for insecticide resistance monitoring in malaria vectors, bio-efficacy and persistence of insecticides on treated surfaces: report of the WHO informal consultation, Geneva, 28-30 September 1998

World Health Organization, 1998, Techniques to detect insecticide resistance mechanisms (field and laboratory manual)

World Health Organization, 2008, World malaria report.

Yadouleton A.W., Martin T., Padonou G., Chandre F., Alex A., Djogbenou L., Dabire R., Aïkpon R., Glitoh I., and Akogbeto M.C., 2011, Cotton pest management strategies on the selection of pyrethroid resistance in Anopheles gambiae populations in northern Benin, Parasites and Vectors, 4: 60

https://doi.org/10.1186/1756-3305-4-60

PMid:21489266 PMCid:PMC3082239

Yawson A.E., McCall P.J., Wilson M.D., and Donnelly M.J., 2004, Species abundance and insecticide resistance of Anopheles gambiae in selected areas of Ghana and Burkina Faso, Med. Vet., Entomol., 18: 372-377

https://doi.org/10.1111/j.0269-283X.2004.00519.x

PMid:15642004

Zhou Z.H., and Syvanen M., 1997, A complex glutathione transferase gene family in the housefly Musca domestica, Mol Gen Genet, 256: 187-194

https://doi.org/10.1007/s004380050560

PMid:9349710